Food Chemistry
Atena Modiri Dovom; Akram Arianfar; Sara Naji-Tabasi; Vahid Hakimzadeh
Abstract
Introduction: Mayonnaise is one of the products which is widely used in most countries. This product, apart from the taste Desirable as a seasoning It creates in food, an effective role in providing nutrients And it has the necessary energy for humans. dietary mayonnaise, The food product is semi-solid ...
Read More
Introduction: Mayonnaise is one of the products which is widely used in most countries. This product, apart from the taste Desirable as a seasoning It creates in food, an effective role in providing nutrients And it has the necessary energy for humans. dietary mayonnaise, The food product is semi-solid or liquid that from emulsification Fat substitutes and vegetable oils With vinegar and other additives are prepared And has less energy and fat It consists of mayonnaise and salad dressing. Fat has the most calories (9 kcal/g) compared to Protein and carbohydrates (4 kcal/g) provides.Mayonnaise is an oil-in-water emulsion And due to having high amounts of fat It causes cardiovascular diseases It is found in consumers. If used from lower amounts of oil To create texture Suitable for use Thickeners It occurs in mayonnaise Gums are part of Construction formula are Most sauces. Due to the great desire To consume low-fat products And also the wide use of this sauce Production of low-fat mayonnaise is important. The purpose of this research Production of reduced fat mayonnaise Using stabilized nano emulsion It is with casein complex Pickering and Gadomeh Shirazi gum.materials and methods : Mayonnaise with reduced oil Contains 30, 40 and 50 percent Pickering emulsion replacement oil respectively at the level of 42, 32 and 22 percent produced and compared with the control sample. Centrifugal and time stability tests, Textural features, Color characteristics, morphology, Organoleptic properties Sauce samples were evaluated.Results and Discussion : The results showed As the replacement percentage increases Nano emulsion containing Pickering particles and reducing the percentage of fat in mayonnaise Emulsion stability She found her mayonnaise sauce Although at a replacement level of 30% nano emulsion, this decrease in stability was not significant(P<0.05). In the time stability test Low-fat mayonnaise with an increase in the percentage of nano emulsion replacement, After 90 days significant difference between the control sample and mayonnaise No significant difference was observed with oil reduced by 30 and 40%. In the colorimetry test It showed that among the factors L*. a*. b Statistically with the sample There was a significant difference.(P≤0/05). brightness In the witness sample, it was 48/85 In connection with RFM50% The least complex of particles Gadomeh Shirazi gum and casein protein and in relation to RFM30% The most complex of particles Gadomeh Shirazi gum and casein were used. Due to the presence of nanoemulsion Contains complex particles Gadomeh Shirazi gum particles and protein. The brightness has decreased In general, from the RFM50% sampleUp to RFM 30% samples simultaneous with increasing amount of nanoemulsion and reduce the amount of fat The brightness is reduced.Conclusion: By replacing the nano emulsion and reducing the amount of fat in the structure of the sauce The amount of tissue stiffness decreased and pheneritis increased. The sensory test of the samples showed, The witness sample has the most general acceptance But there is a significant difference between the samples There was no reduced-fat mayonnaise with the control. Investigating the characteristics of mayonnaise with Reduced fat using Nanoemulsion stabilized with Complex Pickerings Casein and Shirazi Gadomeh gum The results showed that with the increase Reduce the amount of oil up to 30%, Sensory and texture characteristics in a meaningful way decreased. But oil reduction up to 50% in the presence of Pickering nanoemulsion Preserve textural features and promoted in some cases. All emulsions produced of favorable stability During storage and centrifugation had. Best stability in control and sample RFM-30% was observed. Based on the results, Use of nanoemulsion Maintains quality characteristics Mayonnaise with oil Especially reduced In the sample RFM 30%, it was.Also note to the point that Pickering emulsion structure In the digestive system High stability against digestion, is hope Pickering nanoemulsion structure in the production of food products Various low-fat items be investigated further.
Food Technology
Vahid Hakimzadeh; Fatemeh Ghorbanpour; Hassan Rashidi
Abstract
Introduction: One of the relatively new dairy products is cheese sauce, which can increase the consumption of cheese per capita and replace unhealthy sauces. Functionality process by adding useful compounds to food while maintaining its appearance improves properties of foods. Nowadays, due to the importance ...
Read More
Introduction: One of the relatively new dairy products is cheese sauce, which can increase the consumption of cheese per capita and replace unhealthy sauces. Functionality process by adding useful compounds to food while maintaining its appearance improves properties of foods. Nowadays, due to the importance of compounds such as essential fatty acids, antioxidants and fiber, the demand for consuming products containing these compounds in the diet is very high. Date seed extract contains fiber, antioxidants, lignans and essential fatty acids. On the other hand, whey also has many nutritional properties. The purpose of this research is to prepare cheese sauce using such compounds so that while preparing a useful product, it is possible to prevent the wastage of valuable by-products. Material and Methods: In this research, the effect of Date kernel extract in amounts of zero (control), 5 and 15% to cheese sauce formula in the presence (15%) and absence of whey on the physicochemical characteristics of cheese sauce powder samples was investigated. The organoleptic properties of samples, also were studied in 5-hedonic form. All experiments were done based on completely randomized block design and in three replications. Duncan's test was used to compare the average dataResults and Discussion: The results showed that the addition of whey and date kernel extract to the cheese sauce significantly increased the characteristics such as dry matter percentage, powder solubility, phenolic compounds, antioxidant property and viscosity compared to the control sample. But on the other hand, the increase of Date kernel extract and whey in amounts of 15% decreased the amount of protein in cheese sauce. The results of the sensory properties of the samples also showed that the highest acceptability was related to the sample with 5% of seed date extract in the presence of whey.
Food Engineering
Mosatfa Soleymani; Vahid Hakimzadeh; Mostafa Shahidi Noghabi; Akram Arianfar
Abstract
IntroductionAppropriate and effective decolorization of raw and thin juice in sugar refineries is considered as an important process to obtain premium quality sugar, which due to the problems of its conventional process, membrane processes as effective and environmentally friendly processes can be used ...
Read More
IntroductionAppropriate and effective decolorization of raw and thin juice in sugar refineries is considered as an important process to obtain premium quality sugar, which due to the problems of its conventional process, membrane processes as effective and environmentally friendly processes can be used in parts of sugar industries. Among the disadvantages of the usual methods to remove membrane fouling, it can be mentioned the destruction of the membrane, environmental pollution, the remaining detergents in the membrane and the product, especially in the pharmaceutical and food industries, and the increase in production costs. Therefore, it seems that physical methods such as pre-filtration of the incoming feed, using turbulent and pulse currents to prevent excessive compression of the gel layer formed on the membrane surface are more effective and have fewer disadvantages. One of the ways to change the flow of feed entering the membrane surface is bubbling, which causes mixing the flow and increases the tangential shear stress. In fact, the hydrodynamic force that creates bubbles causes both the dragging force and the lifting force and leads to the removal of fouling and reducing the phenomenon of concentration polarization. Materials and Methods In this research, an ultrafiltration membrane (MWCO=10 KDa) pilot with a flat module (effective surface 40 square centimeters) was used to purify raw beet juice (which had passed a stage of pre-treatment with microfiltration) at the temperature of about 30 degrees Celsius and a trans membrane pressure of 3.5 bar during the process. Nitrogen gas in the amount of 0.5, 1 and 1.5 liters per minute was used in two continuous and interrupted modes for bubbling. In this way, in the interrupted mode, after every 3 minutes of filtration, the filtration process was carried out with gas for one minute. The factors such as flux, fouling and membrane resistance as membrane efficiency's factors and parameters like color, purity and turbidity as purification factors was investigated in the form of a completely random design and compared with control filtration conditions (without bubble generation). The results of this research were statistically analyzed using SAS (version 1.9) and Microsoft Office Excel 2019 software. The average data of each test in three repetitions was compared with the least significant difference (LSD) test at the 95% level. Results and DiscussionIncreasing the amount of gas during the bubbling process improved the flow rate. Also, the results showed that the decreasing trend of the permeate flux at the gassing rate of 1.5 L/min was less than other treatments and more stable conditions were seen in the sap flux during the process. Also, the amount of flux in the interrupted form of bubbling showed that after the application of bubbling, although the amount of flux increased, but after that, during the ultra-refining process, the flux decreased again and did not remain constant at that level. But in general, despite the fact that the average flux was higher in the continuous process compared to the interrupted state, there was no significant difference between them. The results related to the amount of membrane fouling after applying the process showed that by applying bubble generation in both continuous and interrupted mods, the fouling was significantly reduced compared to the usual state of ultrafiltration. Also, as the amount of gas entering the feed stream increased, the membrane fouling decreased, which was slightly higher in the continuous state than in the interrupted mod. The overall hydrodynamic resistance of the membrane in different filtration modes showed that the difference between the overall resistance of the membrane in the ultrafiltration and the ultrafiltration process with gasification is quite significant. However, although the overall resistance of the membrane in the interrupted gassing state is higher than its continuous state due to more clogging, there is no significant difference between them (P<0.05).Since the flux changes and the amount of gel layer formation affect the properties of the purified syrup, the properties of the syrup were also investigated in the best flux created in two continuous and interrupted modes. The results showed that the continuous flow of gasification caused a small defect in the purification properties such as purity, color and turbidity due to the improvement of the permeate flow flux, which of course can be ignored in the sugar industry due to the improvement of the permeate flow flux. ConclusionTherefore, in general, it can be said that the discontinuous method, due to less gas consumption during bubbling and no significant difference in the amount of flux compared to the continuous mode, can be considered as the optimal mode of gasification during the experiments conducted in this research be placed.
Food Chemistry
Negar Soleimanpoor Tamam; Akram Arianfar; Vahid Hakimzadeh; Bahareh Emadzadeh
Abstract
Introduction Gelatin is one of the most widely used colloidal proteins, which has unique hydrocolloidal property. Gelatin is derived from collagen by changing the thermal nature. This product is widely used in food, pharmaceutical, biomedical, cosmetic and photography industries. Global gelatin ...
Read More
Introduction Gelatin is one of the most widely used colloidal proteins, which has unique hydrocolloidal property. Gelatin is derived from collagen by changing the thermal nature. This product is widely used in food, pharmaceutical, biomedical, cosmetic and photography industries. Global gelatin demand for food and non-food products is increasing. Two important properties of nanoparticles are: Increasing the surface-to-volume ratio of nanoparticles causes the atoms on the surface to have a much greater effect on their properties than the atoms within the particle volume. The effects of quantum size, which is the second feature. Methods for preparing nanoparticles from natural macromolecules: In general, two major methods for making protein nanoparticles have been reported Emulsion-solvent evaporation method and sedimentation or phase separation method in aqueous medium. Numerous methods have been reported for the preparation of nanoparticles from natural macromolecules. The first method is based on emulsification and the second method is based on phase separation in aqueous medium. In the first method, due to the instability of the emulsion, it is not possible to prepare nanoparticles smaller than 500 nm with a narrow particle size distribution. Therefore, coagulation method or anti-solvent method which is based on phase separation was proposed to prepare nanoparticles from natural macromolecules. Materials and Methods Type B (cow) gelatin was purchased from processing company with Bloom 260-240 food and pharmaceutical Iran solvent gelatin solution of 25% aqueous acetate glutaraldehyde from Iran Neutron Company. Two-stage anti-solvent method was used to produce gelatin nanoparticles. Then, to form nanoparticles, acetone was added dropwise while stirring until the dissolved acetone begins to change color and eventually turns white, which indicates the formation of nanoparticles. Finally, glutaraldehyde solution was added for cross-linking and finally centrifuged. Results and Discussion The results showed that with increasing gelatin concentration, nanoparticle size and PDI increased significantly. According to the announced results, the solvent has a direct effect on the size. Therefore, the best mixing speed is determined to achieve the smallest particle size. Zeta potential is the best indicator for determining the electrical status of the particle surface and a factor for the stability of the potential of the colloidal system because it indicates the amount of charge accumulation in the immobile layer and the intensity of adsorption of opposite ions on the particle surface. If all the particles in the suspension are negatively or positively charged, the particles tend to repel each other and do not tend to accumulate. The tendency of co-particles to repel each other is directly related to the zeta potential. Fabricated gelatin nanoparticles have a stable structure, and are heat resistant. These nanoparticles are ready to be used to accept a variety of aromatic substances, compounds with high antioxidant properties, a variety of vitamins and heat-sensitive substances. ConclusionThe results of this study showed that the optimal conditions for the production of a particle of 88.6 nm at 40 ° C, the volume of acetone consumption was 15 ml, concentration 200 mg and speed 1000 rpm, and the morphology of gelatin nanoparticles have resistant, spherical polymer structure and mesh with a smooth surface that can be clearly seen under an electron microscope.
Raheleh Mahjoub; Vahid Hakimzadeh; Esmaeil Atayesalehi; Jamshid Farmani
Abstract
Introduction: The solidification of edible oils via some techniques like hydrogenation is always accompanied by an increase in the amounts of saturated fatty acids (SFA) and trans fatty acids (TFA). Such fatty acids play a crucial role in cardiovascular diseases which put health of consumers at risk. ...
Read More
Introduction: The solidification of edible oils via some techniques like hydrogenation is always accompanied by an increase in the amounts of saturated fatty acids (SFA) and trans fatty acids (TFA). Such fatty acids play a crucial role in cardiovascular diseases which put health of consumers at risk. Today, various techniques are applied to reduce the amounts of SFA and TFA in fatty-based products. These techniques are including the blending of some fats, esterification and recently oleogel system. In this study, some oleogel systems prepared by mixing monoacyleglycerol (MAG) and polyglycerol ester (PGE) and adding to a mixture of 20% palm stearin oil and 80% rapeseed oil to decrease saturation in shortening were studied. Materials & Methods: This research was conducted to investigate the structuring effect of mono-acilglycerol (MAG) and polyglycerol ester (PGE) to formulate some fatty-based product. For this purpose, various binary mixtures (VBM) of PGE:MAG were added to base oils ( 80% Canola Oil and 20% Palmestearin Oil ) at concentrations of 3, 6 and 9 (wt %) with ratios of 0:100, 20:80, 40:60, 60:40, 80:20, 100:0. Result and Discussion: The results showed that saturated fatty acid (SFA), slip melting point (SMP) and solid fat content (SFC) increased with an increase in the VBM of MAG. MAG did not affect peroxide value and the free fatty acids. Rancimat test presents contradictory results. The rheological analysis revealed that G", G', G* and tan δ of the base oil were increased to 105 Pa. With proper plasticity and low SFA, MAG-based fats can be applicable in the production of some fatty-based products like bakery margarine and all-purpose shortening.Due to the necessity of reduction in SFA content and TFA content in fatty-based products, researchers and producers have prompted to identify the applicable techniques for producing healthy fats. This study was set up in order to introduce the structured fats with low-SFA/TFA suitable in the formulation of shortenings and margarine.
Arezoo Hashemnia; Vahid Hakimzadeh
Abstract
Introduction: When the size of a material is reduced to the nanometer length scale, the electron properties and therefore its chemical properties change greatly. In nanoparticles such as gold and silver, the coherent oscillation of electrons in the conduction strip creates large surface electric fields ...
Read More
Introduction: When the size of a material is reduced to the nanometer length scale, the electron properties and therefore its chemical properties change greatly. In nanoparticles such as gold and silver, the coherent oscillation of electrons in the conduction strip creates large surface electric fields which, when they interact with electromagnetic resonance radiation, their radiant properties rises sharply. This process causes the absorption process of these nanoparticles to be several times stronger than the absorption process of the strongest adsorbent molecules and their scattered light is several times more intense than the organic materials fluorescence. These unique properties provide a high potential for these nanoparticles to be used in many applications such as biochemical sensors, biomedical imaging and medical treatments. Aptamers are single-stranded oligonucleotides, DNA, RNA or proprietary proteins that have the ability to attach specifically to their target. The basis for identifying the target by aptamers is the third structure formed by them. One of the important benefits of aptamers to antibodies is their smaller size, which makes them more easily and effectively penetrated. It also has neither toxicity nor immunogenicity unless in very low levels. Therefore, biosensors that use aptamers as biological identifiers are known as aptasensors. In this research, due to the high losses caused by aflatoxins to the crops and their toxicity, the rapid detection of these pesticides by aptasensor method was investigated. Materials and methods: The test was carried out in a 96-well plate and for each concentration three replicates were considered. In each test, 100 μl of the nano gold solution, which was centrifuged twice at 12000 rpm and at room temperature, was thrown into 11 concentrations and three repetitions in the plate houses. Then adding 15 μlit of aptamer at a concentration of 5 μmol plus 10 μlit of distilled ultrapure water to the houses and incubate for 30 minutes at room temperature. After this time, 25 μlit of different concentrations of aflatoxin plus 15 μlit of 2 molar salt solutions and 35 μlit of distilled water were added to the houses and, after mixing (up and down) in the ELISA reader, absorbed it we read. Results and discussions: At first, with adding the aptamer to Nano gold particles a complex between nanoparticles and aptamer is created. But in present of suitable aflatoxin, the complex of nanoparticle and aptamer is separated and a new complex between aflatoxin and nanoparticle is formed. Subsequently the color is changed to purple. This color change is visible to the eye, indicating that the Aptamer is suitable for Target. In this study, it was found that an aptamer with GTTGGGCACGTGTTGTCTCTCTGTGTCTCGTGCCCTTCGCTAGGCCCACA sequence only affects aflatoxin G1 and other aflatoxins such as B1, B2, and G2 should be considered as another sequencer for Aptamer.
Samaneh Joodi Attar; Vahid Hakimzadeh; Hassan Rashidi
Abstract
Introduction: Cheese is a dairy product that commonly used and has lots of variety in the world. Among the various types of cheese, UF cheese is attracting more consumers in Iran. The need to change the flavor and make a diversity in this product has been considered for long time. Since high fat foods ...
Read More
Introduction: Cheese is a dairy product that commonly used and has lots of variety in the world. Among the various types of cheese, UF cheese is attracting more consumers in Iran. The need to change the flavor and make a diversity in this product has been considered for long time. Since high fat foods such as cheese are the main cause of some disorders like cordial disease, cancer, obesity and diabetes, formulation of dairy products with modified fat or fat replacer was considered by many researchers and suppliers. Vegetable oils can be used as a substitute for milk fat in cheese. Flaxseed oil consists high level of alfa-linolenic acids (Omega-3) and suitable amount of proteins could noticed as a fat replacer. In this study, we investigated the effect of milk fat replacement with flaxseed oil on the production of functional Feta cheese. The rheological, physicochemical, and organoleptic characteristics of such cheese and its optimal formulation were also determined
Materials and methods: The effect of Flaxseed oil (FSO) at a range of 0-100 % and whey protein concentrate (WPC) (0-15%) was investigated on pH, synersis, Dry Matter, hardness, springiness as physicochemical and mechanical properties and mouth feeling, odor, taste overall acceptance as organoleptic properties of UF cheese production by RSM. For the preparation of cheese, a free fat retentate powder was used. To adjust fat to 20%, cream was used with 70% flaxseed oil and homogenized by ultraturrax method. All of the physicochemical, mechanical and organoleptic tests accomplished according to theIranian national Standards/
Results and discussions: Results showed that by increasing the amount of FSO in the formulation of cheese, pH, stiffness and synersis increased. Also, with increasing flaxseed oil, the elasticity was initially decreased and increased in greater quantities afterward. However, by increasing the WPC, the elasticity decreased. The increase of flaxseed oil had a reversible effect on the taste, smell, color and overall cheese acceptance score compared with the control samples due to the presence of some impurities in oil. Increasing the amount of WPC and FSO also caused a decrease in pH and fat during ripening of cheese. Although increasing the level of WPC improved the odor of cheese, but did not have positive effect on appearance, color and general acceptance. The result of optimization of UF cheese production with the following indices: pH 4.82%, synersis 1.35%, fat 20.3%, dry matter 32.45%, hardness 631.46 nm, elasticity 0.94 mm, color 3.4, Odor 3.1, flavor 2.8, texture 3.1 and final acceptance 3.11, showed that the best formulation needs 96.01% of flaxseed oil and 9.73% whey protein concentrate. Finally, the predicted optimal formula by software was also determined as follow: pH 4.78, synersis 1.27%, fat content 19.8%, dry matter 31.4%, the firmness index 618.02, the elasticity 1.03 mm, and the sensory scores included color 3.4 , odor 3.15, Taste 2.97, Texture 3.64 and Final acceptance 3.21.
